Into Unscientific
Chapter 53: The fourth generation, breakthrough!
Chapter 53 The fourth generation, breakthrough!
The cyclization of the target pheromone went very smoothly, but Xu Yun did not relax in the slightest.
This biomedical laboratory is used for 14 days, although on the bright side, as long as the research team solves the synthesis of the fourth-generation imidacloprid within this time, it can be considered a success.
But as mentioned earlier, Xu Yun's ultimate goal is far from being as simple as a four-generation team.
Because this experiment required a lot of equipment, the whole project borrowed the name of Tian Liangwei's auxiliary project from the beginning of the project.
Once the time limit is over, it will be difficult for even Tian Liangwei to provide Xu Yun with such good experimental conditions.
Therefore, this can be said to be Xu Yun's best opportunity at present. Once it is missed, it will delay the research and development of the fifth-generation imidacloprid at least, and may affect the opening of knowledge points and time-space dungeons at worst.
So after completing the cyclization of the target pheromone, Xu Yun and others did not slack off at all, and continued the stirring reaction for 12 hours.
And in the early morning of the next day, the reaction was quenched with saturated NH4Cl aqueous solution under ice cooling.
At this point, the rest is to synthesize the pheromone-binding protein with imidacloprid, which is also the main direction of several biology graduate students.
In layman's terms, this link is an infinite number of chances. The pheromone-binding protein after cyclization is like an iron ring. For better understanding, let's assume that it is divided into twelve grids according to the clock scale.
What Xu Yun and others have to do is to take a small steel ball and throw it from top to bottom. Since they have done ring processing on the direction from 9 to 12 o'clock, the falling point of the steel ball must be between 9-12 o'clock.
But this scale is far from fine enough. Only when the steel ball falls steadily to the number of 46 points can the synthesis of Xu Yun and others be considered successful—please note that this is just a relatively easy-to-understand statement from a macro perspective. In fact, the circle The scale number of the disk is infinitely larger than 12, for example, .
"22440484 pairs!"
In the laboratory, Zhou Peiyao looked at the numbers sequenced by the IlluminaHiSeq high-throughput next-generation sequencing platform, and said to Xu Yun calmly:
"Senior, we have studied the binding ability of two OBPs to target pheromones through small molecule fluorescent competitive binding experiments. The total amount of base data obtained is about 6.6G, and the number of reads after filtering out the original data is 22440484.
The target pheromone has a genome comparison consistency of about 84.62% with the American cockroach sample, and 83.68% with the German cockroach, and the theoretical value of the junction reads is 648! "
22440484 to 648, a probability of 1 in 35,000, this is by no means a simple matter.
Hearing this number, Xu Yun nodded lightly, then turned to look at Qiu Sheng:
"Old Qiu, it's up to us."
Qiu Sheng patted him on the shoulder and said with a smile:
"It's nothing to say, Ganbai, the big deal is to sacrifice all of my buddy's hair here."
As he spoke, his expression became solemn, and he picked up a note similar to a supermarket receipt and glanced at it:
"19.10 and 19.36kDa, the position of the protein electrophoresis band is consistent with the predicted molecular weight, Xiao Ren, let's go to the fluorescence competition binding test directly.
Try to measure the binding ability of 3,11-dimethyl n-hexacosan-2-one and the target pheromone within three hours, so that we will be much more relaxed. "
By the side, Ren Yongcun adjusted his glasses and skillfully combined the two reagents that had been prepared a long time ago.
Xu Yun stood in a well-ventilated ultra-clean bench, and added 1 μg of the quantified target pheromone, 4 μg of Anchored Oligo, 10 μl of 2×ESReactionMix, 1 μl of gDNARemover, and finally added RNase-freeWater until the volume of the mixture was 20 μl.
Then he mixed 20 μl of the mixture by flicking the test tube and handed it to Zhou Peiyao:
"Xiao Zhou, set 42°C, incubate in the PCR instrument for 15 minutes, then heat at 85° for 5 seconds.
Then quantify the synthesized cDNA template, and store it in an environment of minus 20 degrees after passing the 1.2% agarose gel electrophoresis test. "
Zhou Peiyao took the test tube and nodded heavily:
"Don't worry, senior!"
If yesterday’s cyclization experiment was a Cthulhu dog food article, then today’s synthesis experiment is undoubtedly a healing story.
While asleep, it was awakened.
The peers around him urged it:
"Hey, it's time to get up, you haven't moved since the last cycle."
Oh, it came to mind, it is a linear depolymerase, and its sigma factor has not yet been encountered.
Although Christmas was just a few days ago, it was just an ordinary night for it.
He just walked and walked with his companion, and after an unknown period of time, a gentle call came from its ear.
"How are you?"
It turned its head and saw a beautiful figure, slim and graceful, smiling like a flower.
It didn't know how to answer for a while, so it could only say dryly:
"How are you?"
She is so beautiful that it dare not ask for anything, maybe she just came to ask where is the nearest promoter, where the polymerase is much stronger than its synthetic ability.
"That. I'm an Oligo primer. I accidentally lost my way. Can I trouble you to show me the way?"
It looked her in the eyes and said without thinking:
"OK."
It connected her binding domains gentlemanly, and she acquiesced shyly, and they just walked around in the nuclear matrix, counting the beautiful bands on the chromosomes with her.
That's it, I don't know how many cycles have passed.
One day, she suddenly shook its beta pincers in surprise:
"Look there!"
It looked in the direction of her finger, and it was a sequence:
AUGAUACUCUAGGUGGAGUAUUGAUGA
that is not.
Love's password?
She flew all the way over, leaning gently on the -35 sequence, her face fascinated.
Looking at this scene, suddenly, it mustered up the courage:
"That. Can you be my girlfriend?"
Her expression froze suddenly, with a trace of bitterness on her face:
"I'm just a primer, may die tomorrow, our union is cursed"
"Definitely not! We will be happy forever!"
It hugged her and stretched apart the two tightly bound complementary chains.
She didn't make much resistance, so they started their love journey.
Everything is going well. It looks at the chain of messengers extending behind it, and looks back at the cutest girl in its eyes. The urge to protect her for the rest of its life surges in its heart.
To have such a lovely girl to accompany for a lifetime, I am really lucky for three lives!
Just like that, another period of time passed.
However, one day, an accident happened.
The temperature of this world suddenly began to drop, and a large amount of matter began to wither, freeze or even die.
It used all its strength to tightly surround her, but with a jolt, the structural domain that combined it with her suddenly loosened!
It screamed heart-piercingly:
"Hold on to me, don't let go! I'll find a way!"
Her helpless response came from the trembling, with despair and crying:
"It's useless, I can't do it!"
After a burst of circulation, she got farther and farther away from it.
"Complete our messenger chain, I will always love you!"
Her small figure slowly faded out of its sight, disappearing into the icy nuclear layer.
It looked up to the sky and shouted in despair, angrily scolding the injustice of fate.
But the road to go has to go on, but now it is alone.
It struggled to open the glued double strands, and placed the nucleotides one by one, and each base represented its deep yearning for her.
But gradually, it also felt tired.
The surrounding electrons are constantly attacking its core protein, and its subunits are gradually loosened. The most shocking thing is that behind it, a short ubiquitin chain has been extended from some time.
It understands that its life is coming to an end.
When it was dying, her smile flashed in its mind.
It turns out that I have always missed her so much, it turns out that I have always loved her deeply.
Then it dragged its remnant body, walking slowly like this, and finally came to a deep pit.
At this moment, there are countless polymerases identical to it lying in the deep pit. It is not difficult to see from the double strands that they have all met their own version of her.
It moved to a corner with some difficulty, looking at the sky out of focus:
"Does it mean that the combination of primers is doomed to have no results?"
In the haze, her three-dimensional structure appeared in front of him, she seemed to be looking at it with a smile, and opened her arms to it
At a thousandth of an instant when its consciousness was about to dissipate, two figures, one big and one small, suddenly appeared in his peripheral vision:
It was a similar figure to him, and he had no partner by his side, but on one of its chains, it was leading a beautifully carved little girl.
"That is. That is"
His breathing suddenly became rapid.
In fact, it wasn't just him. Almost instantly, due to tio's guiding effect, every 'it' in the deep pit sensed the figure of the person coming.
"Honey, did you see that?!"
It exhausted the last bit of strength in its body, and just laughed like this:
"It turns out that our love is not cursed."
at the same time.
Looking at the extremely small red dot on the hot spot of RPKM value, Xu Yun was inexplicably melancholy:
"The fourth generation has finally broken through."
It’s been a long time since I’ve watched some Chinese manga, and I have a question to ask, why are all Chinese manga now in 3D?
In addition, drive the train today, just change the day to keep fit
(end of this chapter)
You'll Also Like
-
I teach judo in Tokyo.
Chapter 305 18 hours ago -
This young master truly has the ambition of a hero.
Chapter 158 18 hours ago -
Forced to become a pure and innocent female pharmacist in order to cultivate immortality.
Chapter 914 18 hours ago -
We moved to Golden Courtyard
Chapter 894 18 hours ago -
I'm a magnetic field madman
Chapter 704 18 hours ago -
Walnut used me to boost her sales performance.
Chapter 577 18 hours ago -
Only I know the plot of the anime.
Chapter 83 18 hours ago -
He's a pirate, but also a Pokémon Master.
Chapter 90 18 hours ago -
Which top celebrity doesn't support a few female stars?
Chapter 75 18 hours ago -
Tianjin, starting with unorthodox methods to achieve immortality
Chapter 102 18 hours ago